FastQCFastQC Report
金 6 1 2017
sample_1.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamesample_1.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences144813
Sequences flagged as poor quality0
Sequence length101
%GC43

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[FAIL]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GCCCTTTCTCTTCTTATCTCCTCCCAGTTCAAAATGCTTGCATCTTTTAA33932.3430216900416396No Hit
GGCCCTTTCTCTTCTTATCTCCTCCCAGTTCAAAATGCTTGCATCTTTTA22171.530939901804396No Hit
CCTTTCTCTTCTTATCTCCTCCCAGTTCAAAATGCTTGCATCTTTTAATA13710.9467382072051542No Hit
CGCCAGTCTTTTGTCTCTCTCTTCAGCAATGGTGAGGCGGATACCCTTTC9360.6463508110459697No Hit
CTTTCTCTTCTTATCTCCTCCCAGTTCAAAATGCTTGCATCTTTTAATAG6230.43020999495901613No Hit
CCTGCCACAATATTTTTAATTACGTACAAAGATCTGACATGTCACCCAGG6080.4198518088845615No Hit
GGCCGCCAGTCTTTTGTCTCTCTCTTCAGCAATGGTGAGGCGGATACCCT5870.405350348380325No Hit
CCACAATATTTTTAATTACGTACAAAGATCTGACATGTCACCCAGGGACC5670.3915394336143854No Hit
GCCACAATATTTTTAATTACGTACAAAGATCTGACATGTCACCCAGGGAC4270.2948630302528088No Hit
CTGCCACAATATTTTTAATTACGTACAAAGATCTGACATGTCACCCAGGG4050.2796710240102753No Hit
CCCTTTCTCTTCTTATCTCCTCCCAGTTCAAAATGCTTGCATCTTTTAAT3880.2679317464592267No Hit
GCCAGTCTTTTGTCTCTCTCTTCAGCAATGGTGAGGCGGATACCCTTTCC3850.2658601092443358No Hit
GTCCCTTTCTCTTCTTATCTCCTCCCAGTTCAAAATGCTTGCATCTTTTA3530.24376264561883254No Hit
GTTCATTTTTCTTTGCATAATCCAGGGAATCATAAATCATGCCAAAGCCA3260.2251179106848142No Hit
TGCCACAATATTTTTAATTACGTACAAAGATCTGACATGTCACCCAGGGA2860.19749608115293515No Hit
CACGGTTTCAATGGACACTTTTATTGTTTACTTAATGGATCATCAATTTT2830.19542444393804426No Hit
GTGAGTATTAAGAGGGGGGCAGCACATTGGAAGCCCTCATGAGTGCAGGG2680.1850662578635896No Hit
CCTTCCACAATATTTTTAATTACGTACAAAGATCTGACATGTCACCCAGG2430.1678026144061652No Hit
GCCGCCAGTCTTTTGTCTCTCTCTTCAGCAATGGTGAGGCGGATACCCTT2390.16504043145297728No Hit
CTTCCATGTATTCATATTTAGCCAGCTCCTTGATCAGCCGCAGTATGTCA2300.1588255198083045No Hit
CCGCCAGTCTTTTGTCTCTCTCTTCAGCAATGGTGAGGCGGATACCCTTT2290.1581349740700075No Hit
CTTCCACAATATTTTTAATTACGTACAAAGATCTGACATGTCACCCAGGG2180.15053897094874077No Hit
CAGGAAGTAGAATTTATTGGTGAGTATTAAGAGGGGGGCAGCACATTGGA2150.14846733373384988No Hit
CCCCAATCTGCAAGTATCAAAAAGCCCTAATGCAGGCTACCGCATAAGTT1910.13189423601472244No Hit
CACAATATTTTTAATTACGTACAAAGATCTGACATGTCACCCAGGGACCC1830.1263698701083466No Hit
GCGCTTTCTCTTCTTATCTCCTCCCAGTTCAAAATGCTTGCATCTTTTAA1810.12498877863175269No Hit
CCCCACAGGACCATTCCACACAATCTGCTTAGCCCGAGTGACAGCCTCAG1790.12360768715515873No Hit
GGGGGTGTTCGGTCCTTGCGGGCTTCACGAGATCGATTCCTGACTACTTT1720.11877386698707988No Hit
GTCATAGGTAAAATAGTACATGGCAAAACCAACAATGCTGTGTCCTTCCG1700.11739277551048595No Hit
CACTGTTTCAATGGACACTTTTATTGTTTACTTAATGGATCATCAATTTT1700.11739277551048595No Hit
CCAGTCTTTTGTCTCTCTCTTCAGCAATGGTGAGGCGGATACCCTTTCCT1620.11186840960411013No Hit
GACAGGAAGTAGAATTTATTGGTGAGTATTAAGAGGGGGGCAGCACATTG1580.10910622665092223No Hit
GCCCTTGCCAATAACAAAAATGTTGGAAAGTCGAGTGGCAAAGCTGTTGC1580.10910622665092223No Hit
CCCCAATATTGCTTTGAAAATAAACCCCTTGGTTGTTAAGAGGAATTCCA1500.10358186074454641No Hit
GGGCCTTTCTCTTCTTATCTCCTCCCAGTTCAAAATGCTTGCATCTTTTA1480.10220076926795245No Hit
GCCGTTTCTCTTCTTATCTCCTCCCAGTTCAAAATGCTTGCATCTTTTAA1470.1015102235296555No Hit
CCAGTCTCTAAATCAATCTGAATGGTATCATTCACCTTGATGAGGGGATC1450.10012913205306154No Hit
CTCCAGTCTTTTGTCTCTCTCTTCAGCAATGGTGAGGCGGATACCCTTTC1450.10012913205306154No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTCGGGT156.712054E-494.62051
GTCCGCT156.712054E-494.62051
GTCCGCC156.712054E-494.62051
CCCGCAT156.712054E-494.62051
GTGAGAG156.7862985E-494.3591165
AATCGTA255.4392192E-575.487298
CTCCGTG200.002103527570.965371
GGCCCTT4050.068.9211041
GCCGTTT353.4837194E-667.586071
GCCCGTT301.3233408E-463.0803341
ATAATCG301.3415882E-462.906086
CGTCCCT250.00509245456.77231
ACCGATA250.005148542656.615472
CCGGTCA250.005148542656.615474
TTGTTCG250.005148542656.615474
CCCCTAT352.8352655E-454.0688551
ATCGTAA352.8742908E-453.9194959
TAATCGT352.8742908E-453.9194957
CCCCAAT807.2759576E-1153.224031
CAATGGA1250.052.8411069